| Sequence ID | >WENV077092 |
| Genome ID | AADL01001503 |
| Phylum/Class | Acid Mine Drainage microbial communities from Richmond mine |
| Species | |
| Start position on genome | 21561 |
| End posion on genome | 21647 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
atgggttaaa |
| tRNA gene sequence |
GCTGGGATAGCCTAGCCTGGTAAGACGCAGGTCTGGAAAACCTGTGCACGTAAGTGCCCG |
| Downstream region at tRNA end position |
ttttaattta |
| Secondary structure (Cloverleaf model) | >WENV077092 Ser GGA
a GCTC ttttaattta
G - C
C - G
T - A
G - C
G - C
G - C
A - T T A
T C C C T C A
C G A A | | | | | A
C T C C G G G G A G C
T | | | T T
G A G A C
G T A G TGCACGTAAGTGCCC
C - G
A - T
G - C
G - C
T - A
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |