Sequence ID | >W1610946051 |
Genome ID | LUYI01000318 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanomicrobiales archaeon Methan_05 [LUYI] |
Start position on genome | 1569 |
End posion on genome | 1641 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
acttcagagt |
tRNA gene sequence |
GCGGGTGTGGCCAAGTGGTAAGGCAGTACCTTCCCAAGGTACGATTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
agttttttaa |
Secondary structure (Cloverleaf model) | >W1610946051 Gly CCC t TCtt agttttttaa G - C C - G G - C G - C G - C T - A G - C T A T T A C C C A G A G + | | | | G T A C C G G T G G G C G | | | T T G A G G C T A A GATTC G - C T - A A - T C - G C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |