Sequence ID | >W1610947377 |
Genome ID | LVAA01000021 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Syntrophobacterales bacterium Delta_02 [LVAA] |
Start position on genome | 17659 |
End posion on genome | 17742 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gataagaaaT |
tRNA gene sequence |
GCCGAAGTGGTGGAAGTGGCAGACACACCATCTTGAGGGGGTGGCGGGGAGACTCGTGCG |
Downstream region at tRNA end position |
tataagttct |
Secondary structure (Cloverleaf model) | >W1610947377 Leu GAG T ATta tataagttct G - C C - G C - G G - C A - T A - T G - C T A T C G C C C A G A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C C A G A CGGGGAGACTCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |