Sequence ID | >W1610950645 |
Genome ID | LVFD01000008 |
Search identical group | |
Phylum/Class | Fusobacteriota |
Species | Fusobacterium necrophorum subsp. funduliforme [LVFD] |
Start position on genome | 14101 |
End posion on genome | 14177 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aaaaaaatag |
tRNA gene sequence |
GGGGATATAGCTCAGTTTGGGAGAGCGACGCACTTGCACTGCGTAGGTCAGCGGTTCGAT |
Downstream region at tRNA end position |
ttatgcctag |
Secondary structure (Cloverleaf model) | >W1610950645 Ala TGC g ACCA ttatgcctag G - C G - C G + T G - C A - T T - A A - T C T T T C G C C A T G A A | | | | | G T C T C G A G C G G C T | | | | T T G G A G C G G A G AGGTC A - T C - G G - C C - G A - T C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |