| Sequence ID | >W1610954808 |
| Genome ID | LVHR01000026 |
| Phylum/Class | Cyanobacteriota |
| Species | Prochlorococcus marinus str. MIT 1327 [LVHR] |
| Start position on genome | 46203 |
| End posion on genome | 46273 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
tctccctggc |
| tRNA gene sequence |
GGCGGCATGGCCAAGTGGTAAGGCAGAGGATTGCAAATCCTTTATCCCCAGTTCGAATCT |
| Downstream region at tRNA end position |
acaatgtctt |
| Secondary structure (Cloverleaf model) | >W1610954808 Cys GCA
c Ttcg acaatgtctt
G - C
G - C
C - G
G - C
G - C
C - G
A - T T A
T G G G T C A
G A G | | | | | G
T A C C G C C C A G C
G | | | T T
G A G G C
T A A TATC
G + T
A - T
G - C
G - C
A - T
T A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |