Sequence ID | >W1610981386 |
Genome ID | LWCJ01000134 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium kansasii [LWCJ] |
Start position on genome | 6132 |
End posion on genome | 6205 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gacgcgacgg |
tRNA gene sequence |
TCCCCTGTAGCTCAACTGGCAGAGCATTCGGCTGTTAACCGAAGGGTTGAAGGTTCGAGT |
Downstream region at tRNA end position |
ggtctgcacc |
Secondary structure (Cloverleaf model) | >W1610981386 Asn GTT g GCtc ggtctgcacc T - A C - G C - G C - G C - G T + G G - C T G T C T T C C A C A A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C C A A GGGTT T - A T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |