Sequence ID | >W1610981387 |
Genome ID | LWCJ01000134 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium kansasii [LWCJ] |
Start position on genome | 47041 |
End posion on genome | 47115 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gttcccttgc |
tRNA gene sequence |
GGGGCGGTAGCTCAGCTGGTTAGAGCCGCGGACTCATAATCCGTTGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
cagaggtcgc |
Secondary structure (Cloverleaf model) | >W1610981387 Met CAT c ACtt cagaggtcgc G - C G - C G - C G - C C - G G - C G - C C G T C G C C C A C G A A | | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A C TGGTC G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |