Sequence ID | >W1610983551 |
Genome ID | LWEQ01000024 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sulfitobacter sp. HI0023 HI0023 [LWEQ] |
Start position on genome | 6267 |
End posion on genome | 6191 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcccgtcagt |
tRNA gene sequence |
GGACCGATAGCTCAGCTGGATAGAGTACTTGACTACGAATCAAGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ctttgcccca |
Secondary structure (Cloverleaf model) | >W1610983551 Arg ACG t GCCA ctttgcccca G - C G - C A - T C - G C - G G - C A - T T A T C C T C C A C G A A | | + | | G T C T C G G G G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |