Sequence ID | >W1610983702 |
Genome ID | LWET01000068 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alcanivorax sp. HI0033 [LWET] |
Start position on genome | 20480 |
End posion on genome | 20407 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tcagtttaaa |
tRNA gene sequence |
GGCGCGGTGGCAGAGTGGTTATGCAGCGGACTGCAACTCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
attttcgacc |
Secondary structure (Cloverleaf model) | >W1610983702 Cys GCA a TCCA attttcgacc G - C G - C C - G G - C C - G G - C G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T T A GTAC G + T C - G G - C G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |