Sequence ID | >W1610993023 |
Genome ID | LWSU01000237 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas translucens pv. poae [LWSU] |
Start position on genome | 1869 |
End posion on genome | 1942 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tctgcgacat |
tRNA gene sequence |
TGCCCCGTCGCCAAGCGGTAAGGCACCTGACTCTGACTCAGGCATCGGTGGTTCGAATCC |
Downstream region at tRNA end position |
aacaaaaaaa |
Secondary structure (Cloverleaf model) | >W1610993023 Gln CTG t GCCA aacaaaaaaa T - A G - C C - G C - G C - G C - G G - C T A T C T A C C A G A C | + | | | G C A C C G G G T G G C G | | | T T G A G G C T A A CATC C - G C - G T - A G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |