Sequence ID | >W1611007220 |
Genome ID | LXSJ01000013 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Eikenella corrodens [LXSJ] |
Start position on genome | 38241 |
End posion on genome | 38168 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aagctaattt |
tRNA gene sequence |
GGCGGGATAGCAAAGTGGTTATGCAGCGGCCTGCAAAGCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
aaataccaaa |
Secondary structure (Cloverleaf model) | >W1611007220 Cys GCA t TCCA aaataccaaa G - C G - C C - G G - C G - C G - C A - T T T T C A G C C A G A A | | | | G T A A C G G C C G G C G | | | T T G A T G C T T A GTAC G + T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |