Sequence ID | >W1611024530 |
Genome ID | LYXZ01000031 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Labrys sp. WJW [LYXZ] |
Start position on genome | 16805 |
End posion on genome | 16715 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gggtggcaat |
tRNA gene sequence |
GGAGACGTGGCCGAGAGGCTGAAGGCACTCGTTTGCTAAATGAGCATACCCCACAAGGGT |
Downstream region at tRNA end position |
cttcccttcc |
Secondary structure (Cloverleaf model) | >W1611024530 Ser GCT t GCCA cttcccttcc G - C G - C A - T G - C A - T C - G G - C T A T G T C C C A A G A G | | | | | G G G C C G C A G G G C G | | | T T C A G G C T G A A CATACCCCACAAGGGTATC C - G T - A C - G G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |