The detailed information of tRNA gene sequence


Sequence ID>W1611027467
Genome IDLZBG01000020
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesAcinetobacter baumannii [LZBG]
Start position on genome 9433
End posion on genome 9357
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
tctcattata
tRNA gene sequence
GGGCCTATAGCTCAGTCGGTTAGAGCAGCGGACTCATAATCCGTTGGTCCACAGTTCGAG
TCTGTGTGGGCCCACCA
Downstream region at tRNA end position
aatacaaacc
Secondary structure (Cloverleaf model)
>W1611027467	Met	CAT
                   a      ACCA aatacaaacc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T + G
                     A - T          T G
                    T     G T G T C     A
      T G A        A      | | | | |     G
    C       C T C G       C A C A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     TGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK