| Sequence ID | >W1611039566 |
| Genome ID | LZLF01000434 |
| Phylum/Class | Actinomycetota |
| Species | Mycobacterium asiaticum [LZLF] |
| Start position on genome | 77 |
| End posion on genome | 3 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
aggcttcatg |
| tRNA gene sequence |
CGGGGTGTGGCGCAGCTTGGTAGCGCGCTTCGTTCGGGACGAAGAGGCCGTGGGTTCGAA |
| Downstream region at tRNA end position |
nnnnnnnnnn |
| Secondary structure (Cloverleaf model) | >W1611039566 Pro CGG
g ACtc nnnnnnnnnn
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T C G C C C A
C G A G | + | | | G
T C G C G G T G G G C
T | | | | T T
G G C G C
G T A G AGGCC
C - G
T - A
T - A
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |