Sequence ID | >W1611040234 |
Genome ID | LZLU01000062 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium sp. 1165196.3 [LZLU] |
Start position on genome | 84515 |
End posion on genome | 84441 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gaggccgcac |
tRNA gene sequence |
GCCCTCGTATCCCAACTGGCAGAGGAAACGGATTCAAAACCCGTCCAGTGTGAGTTCGAA |
Downstream region at tRNA end position |
aagcgttcgg |
Secondary structure (Cloverleaf model) | >W1611040234 Leu CAA c ACac aagcgttcgg G - C C - G C - G C - G T - A C - G G - C T A T C A C T C A C A A A | | | | | G T C C C T G T G A G C G | | | T T G A G G A C A G A CCAGT A - T C - G G - C G - C A C T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |