| Sequence ID | >W1611040554 |
| Genome ID | LZMA01000253 |
| Phylum/Class | Actinomycetota |
| Species | Mycobacterium colombiense [LZMA] |
| Start position on genome | 3260 |
| End posion on genome | 3334 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
aagcttcaag |
| tRNA gene sequence |
CGGGGTGTGGCGCAGCTTGGTAGCGCGCTTCGTTCGGGACGAAGAGGCCGTGGGTTCGAA |
| Downstream region at tRNA end position |
gtaatcaagg |
| Secondary structure (Cloverleaf model) | >W1611040554 Pro CGG
g ACtc gtaatcaagg
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T C G C C C A
C G A G | + | | | G
T C G C G G T G G G C
T | | | | T T
G G C G C
G T A G AGGCC
C - G
T - A
T - A
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |