Sequence ID | >W1611043106 |
Genome ID | LZSJ01000049 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycolicibacterium fortuitum [LZSJ] |
Start position on genome | 66222 |
End posion on genome | 66296 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gcctgcgacg |
tRNA gene sequence |
GGGCGCGTAGCTCAGTGGTAGAGCTCTGGTTTTACACACCAGCGGTCGGCGGTTCGATAC |
Downstream region at tRNA end position |
acaaaacctc |
Secondary structure (Cloverleaf model) | >W1611043106 Val TAC g ACCA acaaaacctc G - C G - C G - C C - G G - C C - G G - C A T T C T G C C A G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A T CGGTC C - G T - A G - C G - C T - A T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |