Sequence ID | >W1611052522 |
Genome ID | MAFX01000058 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanohalophilus sp. DAL1 [MAFX] |
Start position on genome | 14745 |
End posion on genome | 14816 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ttttgataga |
tRNA gene sequence |
GCGGCTGTGGTTTAGTGGCTATGACCTGAGCTTCCCAAGCTTAGAACCCGGGTTCGAATC |
Downstream region at tRNA end position |
tatgttgggg |
Secondary structure (Cloverleaf model) | >W1611052522 Gly CCC a Attt tatgttgggg G - C C - G G - C G - C C - G T - A G - C T A T G G C C C A T G A G | | | | | G G T T T G C C G G G C G + | | T T C T G A C T A C GAAC T - A G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |