Sequence ID | >W1611054563 |
Genome ID | MAKG01000397 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio breoganii [MAKG] |
Start position on genome | 22646 |
End posion on genome | 22570 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcacagtttt |
tRNA gene sequence |
AGGGGTGTAGCTCCAATTGGCAGAGCAGCGGATTCCAAATCCGCGTGTTGGGAGTTCGAA |
Downstream region at tRNA end position |
tacagaaggc |
Secondary structure (Cloverleaf model) | >W1611054563 Trp CCA t GCCA tacagaaggc A - T G - C G - C G - C G - C T - A G - C T A T C T C T C A A A C A | + | | | G T C T C G G G G A G C T | | | | T T G G A G C G C A A GTGTT G - C C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |