| Sequence ID | >W1630000030 |
| Genome ID | AAOR01000001 |
| Phylum/Class | Euryarchaeota |
| Species | Methanothrix thermoacetophila PT [AAOR] |
| Start position on genome | 142227 |
| End posion on genome | 142153 |
| Amino Acid | Ala |
| Anticodon | CGC |
| Upstream region at tRNA start position |
ccaaatttgT |
| tRNA gene sequence |
GGGCACGTAGATCAGCTGGAAGATCGCTACCTTCGCAAGGTAGAGGCCGCGGGTCCGAAT |
| Downstream region at tRNA end position |
gacggtttta |
| Secondary structure (Cloverleaf model) | >W1630000030 Ala CGC
T ATtc gacggtttta
G - C
G - C
G + T
C - G
A - T
C - G
G - C T A
T C G C C C A
C G A A | | | | | G
T C T A G G C G G G C
G | | | | T C
G G A T C
A A G AGGCC
C - G
T - A
A - T
C - G
C - G
T A
T A
C G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |