Sequence ID | >W1630000699 |
Genome ID | AQYW01000076 |
Search identical group | |
Phylum/Class | Nanoarchaeota |
Species | Nanoarchaeota archaeon SCGC AAA011-L22 [AQYW] |
Start position on genome | 39178 |
End posion on genome | 39250 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gagatattat |
tRNA gene sequence |
GCCTCAGTAGCTTAGTTAGTGGAGCATATCCTTGGTAAGGATAAGGTCGTGGGTGCAAGT |
Downstream region at tRNA end position |
tgcttaaatt |
Secondary structure (Cloverleaf model) | >W1630000699 Thr GGT t Tttc tgcttaaatt G - C C - G C - G T - A C - G A - T G - C T G T T A C C C A T G A A + | | | | A T T T C G G T G G G C A + | | | T G G G A G C T G A AGGTC T - A A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |