Sequence ID | >W1620000062 |
Genome ID | AOLW01000050 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula amylolytica JCM 13557 [AOLW] |
Start position on genome | 24939 |
End posion on genome | 24864 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttcctaatcT |
tRNA gene sequence |
GCCGGGCGGTCCCGCGTGGTGCGGGAACTCGGCTGTTACCCGAGTTGTGCGAGGTTCGAC |
Downstream region at tRNA end position |
ggcttgcact |
Secondary structure (Cloverleaf model) | >W1620000062 Asn GTT T GTgg ggcttgcact G - C C - G C - G G - C G - C G - C C - G T C G G T T C C A G C G G | + | | | G T C C C T C G A G G C G | | | | T T G G G G A T G C A TTGTG C - G T - A C - G G - C G - C C C T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |