| Sequence ID | >WENV079323 |
| Genome ID | AATB01002603 |
| Phylum/Class | Gut microbiome of Mouse lean and obese (C57BL/6J; sample lean2, leptin genotype ob/+) |
| Species | |
|
Start position on genome
|
219
|
|
End posion on genome
|
293
|
|
Amino Acid
|
Arg
|
|
Anticodon
|
CCT
|
|
Upstream region at tRNA start position
|
agattttacc
|
|
tRNA gene sequence
|
GCCCTGGTAGTTCAACGGATAGAATAGGGGTTTCCTAAACCTTAGATAGCAGTTCGATTC TGCTCCGGGGTACAA
|
|
Downstream region at tRNA end position
|
caacatatca
|
| Secondary structure (Cloverleaf model) | >WENV079323 Arg CCT
c ACAA caacatatca
G + T
C - G
C - G
C - G
T + G
G - C
G - C T T
T T C G T C A
C A A A | | | | | G
G C T T G A G C A G C
G | | | + T T
A G A A T
T A A AGAT
G + T
G + T
G - C
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |