| Sequence ID | >WENV008103 |
| Genome ID | AACY020215985 |
| Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
| Species | |
| Start position on genome | 210 |
| End posion on genome | 288 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
aaacagacaT |
| tRNA gene sequence |
CGGAGTGTGGCGCAGCTTGGTAGCGCGTTGCAATGGGGTTGCAAAGGTCGCAGGTTCGAA |
| Downstream region at tRNA end position |
Aaaaagacat |
| Secondary structure (Cloverleaf model) | >WENV008103 Pro GGG
T ACCA Aaaaagacat
C - G
G - C
G - C
A - T
G - C
T - A
G - C T A
T T G T C C A
C G A G + | | | | G
T C G C G G C A G G C
T | | | | T T
G G C G C
G T A G AGGTC
T - A
T - A
G - C
C - G
A - T
A T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |