Sequence ID | >WENV008135 |
Genome ID | AACY020217419 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 404 |
End posion on genome | 326 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
acataataaT |
tRNA gene sequence |
GCGCCTGTAGCTCAGTGGATTAGAGCACCTGACTACGGATCAGGGTGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
Aaaattctga |
Secondary structure (Cloverleaf model) | >WENV008135 Arg ACG T GTTT Aaaattctga G - C C - G G - C C - G C - G T - A G - C T A T C T C T C A T G A A | + | | | G G C T C G G G G A G C G | | | | T T A G A G C T T A A GTGTC C - G C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |