Sequence ID | >WENV084672 |
Genome ID | BABA01006875 |
Search identical group | |
Phylum/Class | Gut microbiome of Human (healthy human sample F2-Y, Child, Female) |
Species | |
Start position on genome | 388 |
End posion on genome | 310 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ccgagttcaT |
tRNA gene sequence |
CGGGTTGTAGCGCAGTCTGGTAGCGCACCTGCATGGGGTGCAGGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
Ttttcccatt |
Secondary structure (Cloverleaf model) | >WENV084672 Pro GGG T ACCA Ttttcccatt C - G G - C G - C G - C T - A T - A G - C T A T T G T C C A T G A A + | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |