Sequence ID | >WENV084932 |
Genome ID | BABA01033067 |
Search identical group | |
Phylum/Class | Gut microbiome of Human (healthy human sample F2-Y, Child, Female) |
Species | |
Start position on genome | 253 |
End posion on genome | 330 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aacagaataT |
tRNA gene sequence |
GGACGGTTAGCTCAGCTGGTAGAGCATCTGCTTGACGTGCAGGAGGTCACAGGTTCGAGT |
Downstream region at tRNA end position |
Tacagttcgt |
Secondary structure (Cloverleaf model) | >WENV084932 Val GAC T ACCA Tacagttcgt G - C G - C A - T C - G G - C G - C T - A T G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A AGGTC T + G C - G T - A G - C C - G T T T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |