| Sequence ID | >WENV085307 |
| Genome ID | BABC01000300 |
| Phylum/Class | Gut microbiome of Human (healthy human sample In-B, Infant, Male) |
| Species | |
|
Start position on genome
|
8783
|
|
End posion on genome
|
8858
|
|
Amino Acid
|
Thr
|
|
Anticodon
|
CGT
|
|
Upstream region at tRNA start position
|
cgggcattgc
|
|
tRNA gene sequence
|
GCCACTTTAGCTCAGTCGGTAGAGCGGCTCACTCGTAATGAGCAGGTCGACAGTTCGATT CTGTCAAGTGGCTCCA
|
|
Downstream region at tRNA end position
|
ttgccctaga
|
| Secondary structure (Cloverleaf model) | >WENV085307 Thr CGT
c TCCA ttgccctaga
G - C
C - G
C - G
A - T
C - G
T - A
T - A T T
T C T G T C A
T G A A | | | | | G
C C T C G G A C A G C
G | | | | T T
G G A G C
T A G AGGTC
G - C
C - G
T - A
C - G
A - T
C A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |