Sequence ID | >WENV086323 |
Genome ID | BABF01000435 |
Search identical group | |
Phylum/Class | Gut microbiome of Human (healthy human sample In-M, Infant, Female) |
Species | |
Start position on genome | 4535 |
End posion on genome | 4612 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
caccacataT |
tRNA gene sequence |
GGACGATTAGCTCAGCTGGGAGAGCGCCTGCCTTACAAGCAGGATGTCGGCAGTTCGATC |
Downstream region at tRNA end position |
Gaaactttag |
Secondary structure (Cloverleaf model) | >WENV086323 Val TAC T ACCA Gaaactttag G - C G - C A - T C - G G - C A - T T - A C T T C T G T C A C G A A | + | | | G T C T C G G G C A G C G | | | | T T G G A G C G A G ATGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |