Sequence ID | >WENV086593 |
Genome ID | BABG01000160 |
Search identical group | |
Phylum/Class | Gut microbiome of Human (healthy human sample In-R, Adult, Female) |
Species | |
Start position on genome | 4571 |
End posion on genome | 4494 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aacacaacaT |
tRNA gene sequence |
CGCGGAGTGGAGCAGTTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGTCTGTTCGAGT |
Downstream region at tRNA end position |
Aaaagaggat |
Secondary structure (Cloverleaf model) | >WENV086593 Met CAT T ACTA Aaaagaggat C A G - C C - G G - C G - C A - T G - C T G T C G G A C A T G A G | + | | | G T C G A G G T C T G C G | | | | T T G G C T C T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |