Sequence ID | >ENV001172 |
Genome ID | AY579925 |
Search identical group | |
Phylum/Class | Environmental sample from ENV division of INSDC |
Species | |
Start position on genome | 501 |
End posion on genome | 578 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tctctatgtT |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGTCAGCGGTTCGAGT |
Downstream region at tRNA end position |
Attaccacct |
Secondary structure (Cloverleaf model) | >ENV001172 Ala TGC T ACTG Attaccacct G - C G - C G + T G - C G - C T - A A - T T G T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |