Sequence ID | >W1730008780 |
Genome ID | FNJF01000028 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Eubacterium maltosivorans limosum [FNJF] |
Start position on genome | 20986 |
End posion on genome | 20913 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttagcagtat |
tRNA gene sequence |
GCGGGTGTAGCTCAGTGGTAGAGCCCTGGCCTTCCAAGCCAGTCGCGAGGGTCCGATTCC |
Downstream region at tRNA end position |
tttatgcaaa |
Secondary structure (Cloverleaf model) | >W1730008780 Gly TCC t TCCA tttatgcaaa G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A G A A + | | | | G T C T C G G A G G G C G | | | | T C G G A G C T A C TCGC C - G T - A G - C G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |