Sequence ID | >W1730023029 |
Genome ID | LWLG01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermosulfurimonas dismutans [LWLG] |
Start position on genome | 332174 |
End posion on genome | 332252 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gggcaaggtt |
tRNA gene sequence |
GGGCCTATAGCTCAGCGTAGGTCAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCG |
Downstream region at tRNA end position |
aatatttggg |
Secondary structure (Cloverleaf model) | >W1730023029 Ile GAT t ACCA aatatttggg G - C G - C G - C C - G C - G T - A A - T T A T C C A C C A G C G A A | | | | | G T C T C G G G T G G C A | | | | T T G G A G C G T C A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |