Sequence ID | >W1710011832 |
Genome ID | AOOV01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus VP551 [AOOV] |
Start position on genome | 772180 |
End posion on genome | 772106 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
taagacctgt |
tRNA gene sequence |
AGGGCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCATTCCCTGGTTCGAATC |
Downstream region at tRNA end position |
taacaaaacg |
Secondary structure (Cloverleaf model) | >W1710011832 Gln TTG t GCCA taacaaaacg A - T G - C G - C G - C C - G T - A A - T T A T G G A C C A G A C | | | | | G C A C C G C C T G G C G | | | T T G A G G C T A A CATTC G - C C - G G - C G - C C - G T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |