Sequence ID | >W1710015256 |
Genome ID | AQHV01000014 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Parabacteroides goldsteinii DSM 19448 = WAL 12034 [AQHV] |
Start position on genome | 327421 |
End posion on genome | 327348 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gcaacagatt |
tRNA gene sequence |
GACTTGGTAGCTCAGTTGGTAGAGCAAATGACTCTTAATCATTGGGTCGAGGGTTCGAGC |
Downstream region at tRNA end position |
aaagaaaaaa |
Secondary structure (Cloverleaf model) | >W1710015256 Lys CTT t ACtc aaagaaaaaa G - C A - T C - G T + G T - A G - C G - C C G T C T C C C A T G A A | | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC A - T A - T T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |