Sequence ID | >W1710015435 |
Genome ID | AQQR01000003 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Marinibacterium profundimaris [AQQR] |
Start position on genome | 645084 |
End posion on genome | 645008 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agccgccagt |
tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGTTAGAGCGCTGGATTGTGGATCCAGAGGTCCCCCGTTCAAG |
Downstream region at tRNA end position |
aaaaattcct |
Secondary structure (Cloverleaf model) | >W1710015435 His GTG t ACCA aaaaattcct G + T C - G C - G G - C C - G C - G T - A C G T G G G G C A T G A A | | | | | A T C T C G C C C C G C G | | | | T T G G A G C T T A G AGGTC C - G T - A G - C G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |