Sequence ID | >W1710023687 |
Genome ID | AVQB01000007 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium breve MCC 0476 [AVQB] |
Start position on genome | 89036 |
End posion on genome | 89111 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aattgaaaac |
tRNA gene sequence |
GGGGCTATAGCGCAGCTGGTAGCGCATCTCCATGGCATGGAGAGGGTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
cgaagccatc |
Secondary structure (Cloverleaf model) | >W1710023687 Ala GGC c ACGA cgaagccatc G - C G - C G + T G - C C - G T - A A - T T A T C C C C C A C G A A | | | | | G T C G C G G G G G G C G | | | | T T G G C G C T A A GGGTC T - A C - G T - A C - G C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |