Sequence ID | >W1710037452 |
Genome ID | AZTW01000032 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Aggregatibacter actinomycetemcomitans serotype d str. SA3033 [AZTW] |
Start position on genome | 25820 |
End posion on genome | 25914 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
atttccaaga |
tRNA gene sequence |
GGAAGATCGTCGTTTCCGGTGAGACGGCAGGACTTCAAATCCTGTTGAGGCTGCCAGCAG |
Downstream region at tRNA end position |
acccacataa |
Secondary structure (Cloverleaf model) | >W1710037452 SeC(p) TCA a GCCA acccacataa G - C G - C A - T A - T G - C A - T T - A C - G T C G C A T C C A C C T T | | | | | A G T T G C G T A G G C G + | | | T T T G A C G G A G TTGAGGCTGCCAGCAGTCTTAG C - G A - T G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |