Sequence ID | >W1710038356 |
Genome ID | BANG01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Gluconobacter frateurii M-2 [BANG] |
Start position on genome | 183 |
End posion on genome | 108 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cacgcctcca |
tRNA gene sequence |
GTCCCGTTCGTCTAGAGGCCTAGGACACTGCCCTTTCACGGCGGCAACACGGGTTCGAAT |
Downstream region at tRNA end position |
atttttttgg |
Secondary structure (Cloverleaf model) | >W1710038356 Glu TTC a ACCA atttttttgg G - C T - A C - G C - G C - G G - C T - A T A T T G C C C A A G A C | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C T A A CAAC C - G T + G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |