Sequence ID | >W1710042245 |
Genome ID | BBBN01000092 |
Search identical group | |
Phylum/Class | Deinococcota |
Species | Thermus sp. JCM 17653 [BBBN] |
Start position on genome | 3705 |
End posion on genome | 3778 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gcttggccgc |
tRNA gene sequence |
TGGGGCGTCGTCTAATGGCAGGACAGCGGACTTTGGATCCGCCGGTCGTGGTTCGAGTCC |
Downstream region at tRNA end position |
gcctttttca |
Secondary structure (Cloverleaf model) | >W1710042245 Gln TTG c GCCA gcctttttca T - A G - C G - C G - C G - C C - G G - C T G T G C A C C A A A C | | | | | G T T C T G C G T G G C G + | | | T T G G G A C C A A CGGT G - C C - G G - C G - C A - T C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |