Sequence ID | >W1710045906 |
Genome ID | BBFA01000363 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Nocardioides sp. JCM 18998 [BBFA] |
Start position on genome | 522 |
End posion on genome | 595 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tctccgcgtc |
tRNA gene sequence |
GCCCCTTTAGCTCAGTCGGCAGAGCGTCTCCATGGTAAGGAGAAGGTCTACGGTTCGATT |
Downstream region at tRNA end position |
ggtaagggaa |
Secondary structure (Cloverleaf model) | >W1710045906 Thr GGT c TCtg ggtaagggaa G - C C - G C - G C - G C - G T - A T - A T T T A T G C C A T G A A | | | | | G C C T C G T A C G G C G | | | | T T G G A G C C A G AGGTC T - A C - G T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |