Sequence ID | >W1710055006 |
Genome ID | BBZR01000029 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridia bacterium UC5.1-1D4 [BBZR] |
Start position on genome | 33333 |
End posion on genome | 33259 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaccgaggat |
tRNA gene sequence |
GTGTTTGTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
gtgtgtttta |
Secondary structure (Cloverleaf model) | >W1710055006 Arg TCT t GCtt gtgtgtttta G - C T - A G - C T + G T - A T - A G - C T A T T T C C C A C G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |