Sequence ID | >W1710059911 |
Genome ID | BCNM01000025 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Paenibacillus pabuli NBRC 13638 [BCNM] |
Start position on genome | 38691 |
End posion on genome | 38766 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
atacatattT |
tRNA gene sequence |
GTCTCAGTAGCTCAGCAGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
agaagaagct |
Secondary structure (Cloverleaf model) | >W1710059911 Arg TCT T GTaa agaagaagct G - C T - A C - G T + G C - G A - T G - C T A T C T C C C A C G A A | + | | | G A C T C G G G G G G C G | | | | T T G G A G C A T A A CGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |