Sequence ID | >W1710067943 |
Genome ID | BCTJ01000006 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Hydrogenophaga palleronii NBRC 102513 [BCTJ] |
Start position on genome | 15034 |
End posion on genome | 14958 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agcccttgtc |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGTTAGAGCAGAGGACTCATAATCCTTTGGTCGTTGGTTCAAG |
Downstream region at tRNA end position |
gtatcccttg |
Secondary structure (Cloverleaf model) | >W1710067943 Met CAT c ACCA gtatcccttg G + T G - C G - C C - G C - G G - C T - A T G T C A A C C A T G A A | | | | | A T C T C G G T T G G C G | | | | T T G G A G C T T A A TGGTC G + T A - T G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |