Sequence ID | >W1710069174 |
Genome ID | BCUM01000012 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingobium cloacae NBRC 102517 [BCUM] |
Start position on genome | 52387 |
End posion on genome | 52462 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttccccgcag |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTAGAGCGTCTCGTTTACACCGAGAATGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
tttctcccaa |
Secondary structure (Cloverleaf model) | >W1710069174 Val TAC g ACCA tttctcccaa G - C G - C G - C C - G G - C A - T T - A C G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |