Sequence ID | >W1710074738 |
Genome ID | BCZF01000024 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Novosphingobium subterraneum NBRC 16086 [BCZF] |
Start position on genome | 44623 |
End posion on genome | 44697 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ccagcggaat |
tRNA gene sequence |
GGCCCCTTCGTCTAGCGGTCAGGACGCGGCCCTCTCACGGCTGAAACACGGGTTCGATTC |
Downstream region at tRNA end position |
ccgttcgtgg |
Secondary structure (Cloverleaf model) | >W1710074738 Glu CTC t ACCA ccgttcgtgg G - C G + T C - G C - G C - G C - G T - A T T T T G C C C A C G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C C A G AAAC C - G G + T G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |