Sequence ID | >W1710078550 |
Genome ID | BDCB01000003 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Nocardia salmonicida NBRC 100376 [BDCB] |
Start position on genome | 33508 |
End posion on genome | 33423 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cggcgcacac |
tRNA gene sequence |
GGCAGATTGCCCGAGCGGCCAATGGGAGCGGACTGTAAATCCGTCGGCTTATGCCTACGT |
Downstream region at tRNA end position |
cgaaccccgt |
Secondary structure (Cloverleaf model) | >W1710078550 Tyr GTA c ACCT cgaaccccgt G - C G - C C - G A - T G - C A - T T - A T A T C A T C C A C G A G | | | | | G G G C C C G T A G G C G + | | | T T C T G G G C A A A CGGCTTATGCCTAC G + T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |