Sequence ID | >W1710078640 |
Genome ID | BDCC01000060 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Nocardia vaccinii NBRC 15922 [BDCC] |
Start position on genome | 80705 |
End posion on genome | 80781 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gcggaagcca |
tRNA gene sequence |
CGGGCTGTGGCGCAGCTTGGTAGCGCACCTGACTGGGGGTCAGGTGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
aagtagggga |
Secondary structure (Cloverleaf model) | >W1710078640 Pro GGG a ACCG aagtagggga C - G G - C G - C G - C C - G T - A G - C T A T T G T C C A C G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A TGGTC C - G C - G T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |