Sequence ID | >W1710079692 |
Genome ID | BDCY01000002 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Microbacterium sp. HM58-2 [BDCY] |
Start position on genome | 1119551 |
End posion on genome | 1119625 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gtttcgccct |
tRNA gene sequence |
TGGGGTATGGTGTAATTGGCAACACGGCTGATTCTGGTTCAGTTGTTCTTGGTTCGAGTC |
Downstream region at tRNA end position |
gacgaaaacc |
Secondary structure (Cloverleaf model) | >W1710079692 Gln CTG t GCCA gacgaaaacc T - A G - C G - C G - C G - C T - A A - T T G T G G A C C A T A A G | + | | | G T T G T G C T T G G C G | | | | T T G A C A C C A G TGTT G + T C - G T - A G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |