Sequence ID | >W1710080627 |
Genome ID | BDDW01000021 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Paenarthrobacter nicotinovorans [BDDW] |
Start position on genome | 36882 |
End posion on genome | 36958 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gccggagcgt |
tRNA gene sequence |
GCCTCCTTAGCTCAGTTGGCCAGAGCACCGCTCTTGTAAAGCGGGGGTCGTCGGTTCGAA |
Downstream region at tRNA end position |
cgaacccctc |
Secondary structure (Cloverleaf model) | >W1710080627 Thr TGT t TCCA cgaacccctc G - C C - G C - G T + G C - G C - G T - A T A T C A G C C A T G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C C C A A GGGTC C - G C - G G - C C - G T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |